waslb

Ensembl ID:
ENSDARG00000006283
ZFIN ID:
ZDB-GENE-040426-718
Description:
Wiskott-Aldrich syndrome-like [Source:RefSeq peptide;Acc:NP_957353]
Human Orthologue:
WASL
Human Description:
Wiskott-Aldrich syndrome-like [Source:HGNC Symbol;Acc:12735]
Mouse Orthologue:
Wasl
Mouse Description:
Wiskott-Aldrich syndrome-like (human) Gene [Source:MGI Symbol;Acc:MGI:1920428]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9782 Nonsense Available for shipment Available now
sa7555 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028016 Nonsense 357 518 9 11
Genomic Location (Zv9):
Chromosome 4 (position 3978943)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4097556
GRCz11 4 4106469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCTCCAGACCAGGYATGGGTGCCCCACCACCTCCTCCTCCACCCAGC[A/T]GAGGCCCCACACAGGCTCCWCCGCCACCCCCACCACCCCATTCGGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028016 Missense 491 518 10 11
Genomic Location (Zv9):
Chromosome 4 (position 3982604)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4101217
GRCz11 4 4110130
KASP Assay ID:
554-4060.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCTTCAGATGGGATTGTGGGAGCRCTRATGGAGGCMATGAAGAACC[G/A]TAGCAAAGTGATCCACTGTTCAGGTGAGCCAAGCTGCTTTTAAAGGGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link