
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mpp5a
- Ensembl ID:
- ENSDARG00000006272
- ZFIN ID:
- ZDB-GENE-020712-1
- Description:
- MAGUK p55 subfamily member 5-A [Source:UniProtKB/Swiss-Prot;Acc:Q8JHF4]
- Human Orthologue:
- MPP5
- Human Description:
- membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) [Source:HGNC Symbol;Acc:18669]
- Mouse Orthologue:
- Mpp5
- Mouse Description:
- membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) Gene [Source:MGI Symbol;Acc:MGI:192
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15209 | Essential Splice Site | Available for shipment | Available now |
sa2908 | Essential Splice Site | F2 line generated | During 2018 |
sa36468 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15209
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014306 | Essential Splice Site | 437 | 703 | 9 | 15 |
ENSDART00000084501 | Essential Splice Site | 437 | 703 | 7 | 13 |
ENSDART00000136167 | Essential Splice Site | 437 | 703 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 17 (position 34398322)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 34283246 GRCz11 17 34231192 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAYAGAGAWGGGGAWGAAGACAACCAGCCTCTTGCTGGCCTCGTCCCTGG[T/C]ACTATGWTTTTACATGCTGTTGTGCTGTTTTTTTTTTTTTTTTCTTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2908
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014306 | Essential Splice Site | 484 | 703 | 11 | 15 |
ENSDART00000084501 | Essential Splice Site | 484 | 703 | 9 | 13 |
ENSDART00000136167 | Essential Splice Site | 484 | 703 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 17 (position 34398643)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 34283567 GRCz11 17 34231513 - KASP Assay ID:
- 554-2827.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACCAAGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAATGATG[G/A]TGAGTGTCTTCAGGCAAACATTAGAGTAAACTACWCACCTTTAAAACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36468
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014306 | Nonsense | 663 | 703 | 15 | 15 |
ENSDART00000084501 | Nonsense | 663 | 703 | 13 | 13 |
ENSDART00000136167 | Nonsense | 663 | 703 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 17 (position 34405922)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 34290846 GRCz11 17 34238792 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGAGCTGCGAGACATTATCGAGAAGGCCCGAGAGATGGAGCAGAACTA[C/A]GGCCACCTGTTTGATGCTGCCATTGTGAACACCGACCTGGACAAATCCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: