vldlr

Ensembl ID:
ENSDARG00000006257
ZFIN ID:
ZDB-GENE-040426-803
Description:
very low-density lipoprotein receptor [Source:RefSeq peptide;Acc:NP_957217]
Human Orthologue:
VLDLR
Human Description:
very low density lipoprotein receptor [Source:HGNC Symbol;Acc:12698]
Mouse Orthologue:
Vldlr
Mouse Description:
very low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:98935]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14068 Nonsense Available for shipment Available now
sa38785 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17714 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023766 Nonsense 280 866 6 19
ENSDART00000139047 Nonsense 280 842 6 18

The following transcripts of ENSDARG00000006257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15315993)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15329300
GRCz11 10 15287419
KASP Assay ID:
2260-3014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTCCATGCCCTTTCCAGCTGCCCGTAACTGCAGACCTGACCAATTC[A/T]AGTGTGATGACGGCAGCTGTATCCATGGCAGCCGACAGTGCAAYGGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023766 Essential Splice Site 352 866 8 19
ENSDART00000139047 Essential Splice Site 352 842 8 18

The following transcripts of ENSDARG00000006257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15319692)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15332999
GRCz11 10 15291118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACATTGATATTCCAGATGTGTAAAAAGCCGCCATTCACTTTGTTCT[A/T]GATATGAATGAATGCTTGATCAATAACGGAGGCTGTTCGCACATCTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023766 Nonsense 563 866 11 19
ENSDART00000139047 Nonsense 563 842 11 18

The following transcripts of ENSDARG00000006257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15324594)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15337901
GRCz11 10 15296020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAACAGYGGCCTGAAGGAACCAGCCTCTATTGMTGTAGACCCTCTAW[C/A]AGGGTAATTTGATTTGGAATGAATATCATTAAAACATTCACACTGCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link