slc27a1

Ensembl ID:
ENSDARG00000006240
ZFIN ID:
ZDB-GENE-050320-112
Description:
solute carrier family 27 (fatty acid transporter), member 1 [Source:RefSeq peptide;Acc:NP_001013555
Human Orthologue:
SLC27A1
Human Description:
solute carrier family 27 (fatty acid transporter), member 1 [Source:HGNC Symbol;Acc:10995]
Mouse Orthologue:
Slc27a1
Mouse Description:
solute carrier family 27 (fatty acid transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1347098]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15160 Nonsense Available for shipment Available now
sa40164 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40165 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Nonsense 145 647 3 13
Genomic Location (Zv9):
Chromosome 3 (position 53196457)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52303772
GRCz11 3 52558435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGGTGGCRCTGTTCATGGAGAGCAGACCCCTTCAGGTGGCACTCTG[G/A]CTGGGCCTGGCCAAAGTCGGTGTGGAAGCTGCACTCATTAACTTCAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Essential Splice Site 243 647 4 13
Genomic Location (Zv9):
Chromosome 3 (position 53201651)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52308966
GRCz11 3 52563629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCCTCGACACCCACCATCCTGCACTGTGTCCAAGGGCTTCAATGG[T/G]GAGATTCACTCTACCAAGGTTTCCTGTTGAGCTGAGTTGTCGAACACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Nonsense 495 647 11 13
Genomic Location (Zv9):
Chromosome 3 (position 53232688)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52340003
GRCz11 3 52594666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCACCCTGTAAACTTTTCTTTTATTCTGGTGACTCTTAGGTGATGTTT[T/A]GGTAATGGACGAGCTTGGATACATGTATTTCCGAGACCGAAGCGGAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link