Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ugt1a5
- Ensembl ID:
- ENSDARG00000006220
- ZFIN IDs:
- ZDB-GENE-040426-2762, ZDB-GENE-071004-4, ZDB-GENE-071004-5, ZDB-GENE-080227-3, ZDB-GENE-080227-5, ZDB-GENE-080227-5, ZDB-GENE-080227-6, ZDB-GENE-080227-7, ZDB-GENE-080227-7
- Description:
- UDP glycosyltransferase 1 family, polypeptide A1 precursor [Source:RefSeq peptide;Acc:NP_001032505]
- Human Orthologues:
- UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
- Human Descriptions:
- UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
- UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
- UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
- UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
- UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
- UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
- UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
- UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
- UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
- Mouse Orthologues:
- Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
- Mouse Descriptions:
- UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
- UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
- UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
- UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
- UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
- UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
- UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
- UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
- UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa8443 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa8617 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa18078 | Nonsense | Available for shipment | Available now |
| sa34568 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa15206 | Nonsense | Available for shipment | Available now |
| sa27349 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8443
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | Nonsense | 21 | 520 | 1 | 5 |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | Nonsense | 28 | 527 | 1 | 5 |
| ENSDART00000130243 | None | 520 | None | 5 | |
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | Nonsense | 21 | 520 | 1 | 5 |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | Nonsense | 28 | 527 | 1 | 5 |
| ENSDART00000130243 | None | 520 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10228430)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10032277 GRCz11 9 10003650 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8617
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | Nonsense | 21 | 520 | 1 | 5 |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | Nonsense | 28 | 527 | 1 | 5 |
| ENSDART00000130243 | None | 520 | None | 5 | |
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | Nonsense | 21 | 520 | 1 | 5 |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | Nonsense | 28 | 527 | 1 | 5 |
| ENSDART00000130243 | None | 520 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10228430)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10032277 GRCz11 9 10003650 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18078
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | Nonsense | 94 | 520 | 1 | 5 |
| ENSDART00000124516 | None | 520 | None | 5 | |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | None | 527 | None | 5 | |
| ENSDART00000130243 | None | 520 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10222586)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10026433 GRCz11 9 9997806 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGATAMAGGAGATTGTGMAAGCCGGTGTTACAACTCTGATAAGTACTTA[T/A]GTATCTACAGATCTGSCYAGGTTTCAGAGTTTCATCAACAGAATGAATTY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34568
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | Nonsense | 255 | 526 | 1 | 5 |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | None | 520 | None | 5 | |
| ENSDART00000125852 | Nonsense | 265 | 536 | 1 | 5 |
| ENSDART00000127780 | None | 527 | None | 5 | |
| ENSDART00000130243 | None | 520 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10206685)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10010532 GRCz11 9 9981905 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGGACACCTCATACGCAGAGCTGTTAGGTCACGGTGCAGTTTGGCTTT[T/A]AAGGTACGACTTCAGCTTTGAATACCCTAAACCCCAAATGCCAAACATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15206
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | None | 525 | None | 5 | |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | None | 520 | None | 5 | |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | None | 527 | None | 5 | |
| ENSDART00000130243 | Nonsense | 5 | 520 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10205470)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10009317 GRCz11 9 9980690 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCTTCTCCTGCCACTGTACTTCACATCATTGAYAAATGGCTTGCTTGTG[G/A]TTGCTCGGGAGTCTGCTCCTCCTTGGTTCAGCTGAAGCTGGGAAACTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27349
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000010246 | Nonsense | 16 | 525 | 1 | 5 |
| ENSDART00000014518 | None | 526 | None | 5 | |
| ENSDART00000081463 | None | 520 | None | 5 | |
| ENSDART00000102448 | None | 342 | None | 6 | |
| ENSDART00000121990 | None | 519 | None | 5 | |
| ENSDART00000123415 | None | 515 | None | 5 | |
| ENSDART00000124423 | None | 520 | None | 5 | |
| ENSDART00000124516 | None | 520 | None | 5 | |
| ENSDART00000125852 | None | 536 | None | 5 | |
| ENSDART00000127780 | None | 527 | None | 5 | |
| ENSDART00000130243 | None | 520 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10202534)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10006381 GRCz11 9 9977754 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGATGAGAACACTGCCTGTTCCTGCTCAGGGGCTTCTCGCCTTGCTGTG[C/A]TTGTTCTCTTTTGAGTCTGTGCAAGCTGGAAAGGTGCTTGTCTTACCAGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder: Family-based genome-wide association scan of attention-deficit/hyperactivity disorder. (View Study)
- Bilirubin levels: A genome-wide association study for serum bilirubin levels and gene-environment interaction in a Chinese population. (View Study)
- Bilirubin levels: Common variants in the SLCO1B3 locus are associated with bilirubin levels and unconjugated hyperbilirubinemia. (View Study)
- Bilirubin levels: Genome-wide association meta-analysis for total serum bilirubin levels. (View Study)
- Bilirubin levels: UGT1A1 is a major locus influencing bilirubin levels in African Americans. (View Study)
- Cholelithiasis-related traits in sickle cell anemia: A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia. (View Study)
- Circulating cell-free DNA: A genome-wide association study identifies UGT1A1 as a regulator of serum cell-free DNA in young adults: The Cardiovascular Risk in Young Finns Study. (View Study)
- Metabolite levels: A genome-wide assessment of variability in human serum metabolism. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
- Crigler-Najjar syndrome, type I
- Crigler-Najjar syndrome, type II
- Hyperbilirubinemia, familial transcient neonatal
- Bilirubin, serum level of, QTL1
- Gilbert syndrome
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
