zgc:158450

Ensembl ID:
ENSDARG00000006200
ZFIN ID:
ZDB-GENE-070112-702
Description:
eukaryotic translation initiation factor 4 gamma, 1 [Source:RefSeq peptide;Acc:NP_001073669]
Human Orthologue:
EIF4G1
Human Description:
eukaryotic translation initiation factor 4 gamma, 1 [Source:HGNC Symbol;Acc:3296]
Mouse Orthologue:
Eif4g1
Mouse Description:
eukaryotic translation initiation factor 4, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:2384784]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32877 Nonsense Mutation detected in F1 DNA During 2018
sa19719 Essential Splice Site Available for shipment Available now
sa19718 Nonsense Available for shipment Available now
sa31270 Nonsense Available for shipment Available now
sa39804 Nonsense Mutation detected in F1 DNA During 2018
sa30815 Nonsense Mutation detected in F1 DNA During 2018
sa32876 Nonsense Mutation detected in F1 DNA During 2018
sa6009 Nonsense Mutation detected in F1 DNA During 2018
sa15272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 99 1592 4 30
ENSDART00000087120 Nonsense 88 1585 6 32
ENSDART00000145778 Nonsense 99 155 7 8
Genomic Location (Zv9):
Chromosome 2 (position 16559029)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17145954
GRCz11 2 16814544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAACACCACCCGGCCTGTTGCACCTACTCATGTCTACCAACCTACCT[C/A]ACAGGTTATGATGATTCCCCAGCAACAGTTGCAGTTCGCCGCTAACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Essential Splice Site 156 1592 None 30
ENSDART00000087120   145 1585 7 32
ENSDART00000145778   156 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16558781)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17146202
GRCz11 2 16814792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTGGAACTGCAGGCTTTTATGGTGGAAGCAGTCCAGCTGAATACGG[T/C]ACATATGGTAAGAGGCTCTTCTCTGGGCCTCCCCTGCTTGTTTGACCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 182 1592 6 30
ENSDART00000087120 Nonsense 175 1585 8 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16554603)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17150380
GRCz11 2 16818970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAACGCCAGTGCCTCCTACACCTGTGATGATGAACCCTGCTCAGCAG[C/T]AACAGGCTCCACTTCCACAGCAAGCTGCTCCACAGCCGACAGGGCCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 422 1592 9 30
ENSDART00000087120 Nonsense 415 1585 11 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16551892)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17153091
GRCz11 2 16821681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGCCCCTGTAATCACAGAGATGCCCGTTCCAGAACTGGCTGCCGAT[G/T]AGCCAAAGGAACAGCCTTTGTTAAACGGTTTGCCCCAGGACTCTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 578 1592 11 30
ENSDART00000087120 Nonsense 571 1585 13 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16551181)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17153802
GRCz11 2 16822392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTCGACACAGAAAATATTGAGCCAGAGGCATCTAAACCTGTGGAA[C/T]AGAAATATCAATATAAAGAAGGTTAGAAGCAAAGTTAAATAAGCTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 581 1592 11 30
ENSDART00000087120 Nonsense 574 1585 13 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16551172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17153811
GRCz11 2 16822401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGAAAATATTGAGCCAGAGGCATCTAAACCTGTGGAACAGAAATAT[C/T]AATATAAAGAAGGTTAGAAGCAAAGTTAAATAAGCTTCATTAAAGATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 717 1592 14 30
ENSDART00000087120 Nonsense 710 1585 16 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16549102)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17155881
GRCz11 2 16824471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAACCAGGCTGAGAACGCTTGGACACCCTCGGTCAAGAAGCAAGTA[C/T]GAAGTCGTGGAGAAGAGGAGGAGGATGATGCGGAAGCCGCTAAAACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 753 1592 14 30
ENSDART00000087120 Nonsense 746 1585 16 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16548994)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17155989
GRCz11 2 16824579
KASP Assay ID:
554-3782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCCGYGTGCGCAGTGTCCTGAACAAGCTCACACCACAGATGTTCCAG[C/T]AGCTGATGAAGCAGGTGACCGAGCTCGCCATAGACACTGAAGAGAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087107 Nonsense 757 1592 14 30
ENSDART00000087120 Nonsense 750 1585 16 32
ENSDART00000145778   None 155 None 8
Genomic Location (Zv9):
Chromosome 2 (position 16548982)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17156001
GRCz11 2 16824591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTGTCCTGAACAAGCTCACACCACAGATGTTCCAGYAGCTGATGAAG[C/T]AGGTGACCGAGCTCGCCATAGACACTGAAGAGAGGCTCAAGGGTGTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link