
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sav1
- Ensembl ID:
- ENSDARG00000006196
- ZFIN ID:
- ZDB-GENE-040912-28
- Description:
- protein salvador homolog 1 [Source:RefSeq peptide;Acc:NP_001004560]
- Human Orthologue:
- SAV1
- Human Description:
- salvador homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17795]
- Mouse Orthologue:
- Sav1
- Mouse Description:
- salvador homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927144]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31951 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31951
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012357 | Nonsense | 147 | 397 | 2 | 5 |
ENSDART00000121782 | Nonsense | 147 | 412 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 13 (position 37197311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 36669613 GRCz11 13 36795445 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGCCCGTATTACTATCCTCCAGAACCATACTACAATAACCAACCCAGA[C/T]GAGCACGCAGACCAGACCACTTTAATGAGAACTACAGATACTATGACCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: