zgc:101782

Ensembl ID:
ENSDARG00000006174
ZFIN ID:
ZDB-GENE-041010-153
Description:
leucine-rich repeat-containing protein 23 [Source:RefSeq peptide;Acc:NP_001006054]
Human Orthologue:
LRRC23
Human Description:
leucine rich repeat containing 23 [Source:HGNC Symbol;Acc:19138]
Mouse Orthologue:
Lrrc23
Mouse Description:
leucine rich repeat containing 23 Gene [Source:MGI Symbol;Acc:MGI:1315192]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29907 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004871 Essential Splice Site 70 326 2 7

The following transcripts of ENSDARG00000006174 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20421926)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20207033
GRCz11 23 20133376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAATGGTCTGTCTCATGCCTATGTCAGACTTGATCTTAAAAATAAG[T/G]AAGTTTGTTCGTTCAATAACACTTTTTAGTAGACTTTAGATATTCTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link