
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LRRK2
- Ensembl ID:
- ENSDARG00000006169
- Description:
- leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
- Human Orthologue:
- LRRK2
- Human Description:
- leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
- Mouse Orthologue:
- Lrrk2
- Mouse Description:
- leucine-rich repeat kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1913975]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6814 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30308 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38142 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa8399 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa5114 | Essential Splice Site | F2 line generated | During 2018 |
sa6813 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6814
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Essential Splice Site | 390 | 2538 | 12 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36745641)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35153257 GRCz11 25 35658196 - KASP Assay ID:
- 554-4860.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTGCTTCTCCATTGCAACACAWCCAACMATGYGGAACTGGAAGGAAGG[T/G]TAGCGTTCCTTAATGTYRTGCGCTACATTACAGATTTGCATTCAGGAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30308
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Essential Splice Site | 971 | 2538 | 28 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36728695)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35136311 GRCz11 25 35641250 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTTTTATACATGAACACCCCTTCAAATAAAGCGTTGTCATTTTTTTT[A/C]TCTGATGTCCTCAGGTCAGGGTTTCTCTGAGAGTTTCTCCAGTCCTGTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38142
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Essential Splice Site | 1260 | 2538 | 33 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36724826)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35132442 GRCz11 25 35637381 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGGGCCCGACTGGAGAAACTGCACTTAAGCTTCAACAGACTCACTGAG[G/A]TACTGTATGATTCGGCTCTGCACTGATGTCCGGGCCGTTCTCTGACTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8399
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Essential Splice Site | 1768 | 2538 | 42 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36714205)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35121821 GRCz11 25 35626760 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAAACCCAGCTAGTTTCATCAAGATCACCGTTCCATGCTCTCGCAAAG[G/A]TAAAAGANNAACTTSTWTTGCAGTGTTTGGACYNNCTTAAACACTTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5114
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Essential Splice Site | 1882 | 2538 | 45 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36711224)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35118840 GRCz11 25 35623779 - KASP Assay ID:
- 554-3533.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGACAAGCATGAAGGCAATGTGGATCGAAAGTAACNNTGTGTTTTTATAC[T/C]GAAGGGGATGGAGGTTTTGGCTCGGTTTATAAAGCTKTSTACAAGAATGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6813
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027174 | Nonsense | 2153 | 2538 | 50 | 57 |
- Genomic Location (Zv9):
- Chromosome 25 (position 36707958)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35115574 GRCz11 25 35620513 - KASP Assay ID:
- 554-5366.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAGATGTTGTGTCTGAYGCGAGAGCTGAATGTTGTGGGTTTTCCAGGC[G/T]AGTGTTTTGTCGTGTCCAATTCAGGCGGAGCTGCAAACGGAGGTAAAAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Parkinson's disease: Comprehensive research synopsis and systematic meta-analyses in Parkinson's disease genetics: The PDGene database. (View Study)
- Parkinson's disease: Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. (View Study)
- Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)
- Parkinson's disease: Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: