star

Ensembl ID:
ENSDARG00000006137
ZFIN ID:
ZDB-GENE-001120-3
Description:
Steroidogenic acute regulatory protein, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q9DG10]
Human Orthologue:
STAR
Human Description:
steroidogenic acute regulatory protein [Source:HGNC Symbol;Acc:11359]
Mouse Orthologue:
Star
Mouse Description:
steroidogenic acute regulatory protein Gene [Source:MGI Symbol;Acc:MGI:102760]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31674 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016225 Essential Splice Site 153 285 None 7

The following transcripts of ENSDARG00000006137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46835035)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44712047
GRCz11 8 44705953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATGGAACAAATGGGGGAGTGGAACCCCAATGTCAAGCAAGTCAAGG[T/C]GGGTAAAAATGGCTGATTTACTGATAAATCTATTATTTTTATTCCAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link