zgc:63504

Ensembl ID:
ENSDARG00000006112
ZFIN ID:
ZDB-GENE-040426-1138
Description:
Zgc:63504 protein [Source:UniProtKB/TrEMBL;Acc:Q6P405]
Human Orthologue:
MYOF
Human Description:
myoferlin [Source:HGNC Symbol;Acc:3656]
Mouse Orthologue:
Myof
Mouse Description:
myoferlin Gene [Source:MGI Symbol;Acc:MGI:1919192]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27901 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8428 Nonsense Mutation detected in F1 DNA During 2018
sa18158 Essential Splice Site Available for shipment Available now
sa35223 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Essential Splice Site 48 1557 2 42
ENSDART00000144283 Essential Splice Site 48 2030 2 53
Genomic Location (Zv9):
Chromosome 12 (position 11645873)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10528944
GRCz11 12 10566787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAAACAAGGTCGATTAACAATGAAGTGAATCCGGTGTGGAATGAGG[T/C]CTGTTGAGATATTCAAGTTTAAATCTTTAATGATTTTGCAAATGAGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Nonsense 503 1557 17 42
ENSDART00000144283 Nonsense 503 2030 17 53
Genomic Location (Zv9):
Chromosome 12 (position 11623635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10506706
GRCz11 12 10544549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCTGAGGGAGTTCTCAGGTTTACCTGACCCATATGATGACCTTAATT[T/A]AGGCAAGGTAAGTGAAGTAAWRCATTTTAAGTCTCTCTTCCARAGTTYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Essential Splice Site 1129 1557 31 42
ENSDART00000144283 Essential Splice Site 1129 2030 31 53
Genomic Location (Zv9):
Chromosome 12 (position 11614502)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10497573
GRCz11 12 10535416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTACCAGGCCAGAAACCTTACTGCYYTAGACCAAGAYAGTTTTTCAG[G/A]TGTTCTAGCAGTTTTCCTTTGTTTATAATAAMTGTGACAAGGCTTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Nonsense 1439 1557 39 42
ENSDART00000144283 Nonsense 1439 2030 39 53
Genomic Location (Zv9):
Chromosome 12 (position 11606852)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10489923
GRCz11 12 10527766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTAAGTTTTATGCTTCCCTTGGACAAAGTGAGAAATGCCGTCCATA[T/A]CTTGACAAAGGATATGACACACTGGAGGTGAGTGTCTATACTGTAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link