uck2a

Ensembl ID:
ENSDARG00000006074
ZFIN ID:
ZDB-GENE-030131-7158
Description:
Uridine-cytidine kinase 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SYM0]
Human Orthologue:
UCK2
Human Description:
uridine-cytidine kinase 2 [Source:HGNC Symbol;Acc:12562]
Mouse Orthologue:
Uck2
Mouse Description:
uridine-cytidine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1931744]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31649 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002186 Nonsense 187 261 5 7

The following transcripts of ENSDARG00000006074 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 21664804)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21094701
GRCz11 8 21126786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACATCAGTGAGAGAGGCCGTGACCTGGAGCAAGTGCTAAACCAGTA[C/A]ATAACATTTGTTAAGCCTGCCTTTGAGGAGTTCTGTCTGCCAGTGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link