
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ric8b
- Ensembl ID:
- ENSDARG00000005972
- ZFIN IDs:
- ZDB-GENE-030131-6435, ZDB-GENE-030131-6435
- Description:
- Synembryn-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ9]
- Human Orthologue:
- RIC8B
- Human Description:
- resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25555]
- Mouse Orthologue:
- Ric8b
- Mouse Description:
- resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36603 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1716 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa36602 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa13369 | Essential Splice Site | Available for shipment | Available now |
sa17855 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa36603
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019818 | Nonsense | 139 | 536 | 3 | 10 |
ENSDART00000091428 | Nonsense | 139 | 282 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 14907152)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15352570 GRCz11 18 15321082 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCCCTTAAGTGCCTGTGCAACGTAGTGTTCAATAGCGTGCCGGCACAG[C/T]AGATGGGAGGTGACTTGCAGTTAGCGGAAGGCCTATGCCCCCGCTTGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1716
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019818 | Nonsense | 200 | 536 | 3 | 10 |
ENSDART00000091428 | Nonsense | 200 | 282 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 14906968)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15352386 GRCz11 18 15320898 - KASP Assay ID:
- 554-1662.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCCACGCTTCAGAAGGAGGCAGGCGCGGTGAAACTACTCACTAATGTGT[T/A]GGAACGCACTCTTGATGTGCGTTGGGTTGGGCCATATGAGGCTGCACCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36602
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019818 | Essential Splice Site | 282 | 536 | 4 | 10 |
ENSDART00000091428 | Essential Splice Site | 282 | 282 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 14904589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15350007 GRCz11 18 15318519 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTAATGCTGAAAACACACACTGAAGAAAAAACTGAGGAGACTCACAGG[T/C]ACTTCCAAACTAGGGCTGCACGTTATTGGAAAAATCTGATATTGCCATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13369
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019818 | Essential Splice Site | 413 | 536 | 7 | 10 |
ENSDART00000091428 | None | 282 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 14897642)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15343060 GRCz11 18 15311572 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGAAACAGGGGGCTGCTGAGTTCCTGTTTGTGCTCTGCAAGGAGAGTGG[T/A]AAGTTCTGCTTCAYAATGGTGCAGTTTTATACATAATAGTTTTCATACTW
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17855
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019818 | Nonsense | 455 | 536 | 8 | 10 |
ENSDART00000091428 | None | 282 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 14895553)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15340971 GRCz11 18 15309483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGGAGAGACGCAGTACTCRTCTGATGAAGACTCTGACACTGAGGAGTA[C/A]AAGTCYGTCAAACCATTGTAAGTGCCTTTTTGTGTATGCATAACNTTCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: