v2rl1

Ensembl ID:
ENSDARG00000005942
ZFIN ID:
ZDB-GENE-050419-65
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A8E7K1]
Mouse Orthologues:
AC113321.1, AC116599.2, AC119863.1, Vmn2r1, Vmn2r2, Vmn2r5, Vmn2r7
Mouse Descriptions:
vomeronasal 2, receptor 1 Gene [Source:MGI Symbol;Acc:MGI:3645892]
vomeronasal 2, receptor 2 Gene [Source:MGI Symbol;Acc:MGI:3757666]
vomeronasal 2, receptor 3 [Source:RefSeq peptide;Acc:NP_001098084]
vomeronasal 2, receptor 5 Gene [Source:MGI Symbol;Acc:MGI:3649074]
vomeronasal 2, receptor 7 Gene [Source:MGI Symbol;Acc:MGI:2441693]
vomeronasal receptor Vmn2r4 [Source:RefSeq peptide;Acc:NP_001098085]
vomeronasal receptor Vmn2r6 [Source:RefSeq peptide;Acc:NP_001098089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5913 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027938 Nonsense 220 899 3 7
ENSDART00000126115 Nonsense 220 929 3 6
Genomic Location (Zv9):
Chromosome 18 (position 32462033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 34258590
GRCz11 18 34234614
KASP Assay ID:
554-3960.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGAGAACCAGTCTGTTGCGATGGCAAAACTGGTCCTTCGYTTTGGCT[G/A]GACTTGGGTGGGTACCATCGCTGCCGAGGATGACTATGGGAAATACGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link