zgc:101668

Ensembl ID:
ENSDARG00000005872
ZFIN ID:
ZDB-GENE-041114-147
Description:
rho GTPase-activating protein 28 [Source:RefSeq peptide;Acc:NP_001007436]
Human Orthologue:
ARHGAP28
Human Description:
Rho GTPase activating protein 28 [Source:HGNC Symbol;Acc:25509]
Mouse Orthologue:
Arhgap28
Mouse Description:
Rho GTPase activating protein 28 Gene [Source:MGI Symbol;Acc:MGI:2147003]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9396 Nonsense Mutation detected in F1 DNA During 2018
sa32504 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125591 Nonsense 162 619 4 15
Genomic Location (Zv9):
Chromosome 24 (position 43572212)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41907950
GRCz11 24 41872320
KASP Assay ID:
2261-9174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTCTGARCTGACGYCTCCTGTTTCCCCGAATRGAGAGATCTCCCCC[A/T]AACCCCCGCAGTCGAATCCTCCTAAAGGTCAGACAACATCAGATTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125591 Essential Splice Site 529 619 12 15
Genomic Location (Zv9):
Chromosome 24 (position 43557755)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41891598
GRCz11 24 41791651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCAAACGTGGACTTTTGAGTCGGTGGAAGGACCGCGAGCGCAGTGAA[G/A]TGAGTGATCGTAGGATTTAATCGTCAGATGAGGGGGCTAATACTTAATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link