udu

Ensembl ID:
ENSDARG00000005867
ZFIN IDs:
ZDB-GENE-070117-2447, ZDB-GENE-070117-2447
Description:
Ugly duckling [Source:UniProtKB/TrEMBL;Acc:A4ZXU1]
Human Orthologues:
GON4L, YY1AP1
Human Descriptions:
gon-4-like (C. elegans) [Source:HGNC Symbol;Acc:25973]
YY1 associated protein 1 [Source:HGNC Symbol;Acc:30935]
Mouse Orthologue:
Gon4l
Mouse Description:
gon-4-like (C.elegans) Gene [Source:MGI Symbol;Acc:MGI:1917579]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42743 Nonsense Mutation detected in F1 DNA During 2018
sa42744 Nonsense Mutation detected in F1 DNA During 2018
sa36167 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39105 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22866 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088023 Nonsense 41 2055 2 31
ENSDART00000124238 Nonsense 41 2055 1 36
Genomic Location (Zv9):
Chromosome 16 (position 31223610)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29060799
GRCz11 16 28995422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGCAGATCTCCTAGCTCATGGAAGAGGAAGGCCTCTACACCCAGT[A/T]AAACAAAGAGCTGGACCTCCATTCAGTCCCTTTCTCCAGACAGGCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088023 Nonsense 166 2055 4 31
ENSDART00000124238 Nonsense 166 2055 3 36
Genomic Location (Zv9):
Chromosome 16 (position 31226888)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29064077
GRCz11 16 28998700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAGAAGATGAGAATGAGGAAGAGCTCAGGAAGCTGGACAGAGATT[T/A]AACACTCAAATCTAAAAAACTCAACCTCTCCTCTATCAATGTTCGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088023 Essential Splice Site 447 2055 11 31
ENSDART00000124238 Essential Splice Site 447 2055 10 36
Genomic Location (Zv9):
Chromosome 16 (position 31231654)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29068843
GRCz11 16 29003466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCCAGTGGCTGCAAGGACTCATGACATCTCATCTGGACAACGACGG[T/C]CAGCAAGCCTTTTTTTATGATCAAATTCAACTTTTAATATCAGTTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088023 Essential Splice Site 599 2055 15 31
ENSDART00000124238 Essential Splice Site 599 2055 14 36
Genomic Location (Zv9):
Chromosome 16 (position 31237374)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29074563
GRCz11 16 29009186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTCACACCTGCACAGAGGATACAGCTGCAACAGCAAATACAGCAAG[T/C]AAGACTAAACAGTTTTAAACACCACCAAACATTCTTAATGTACTGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088023 Essential Splice Site 788 2055 20 31
ENSDART00000124238 Essential Splice Site 788 2055 19 36
Genomic Location (Zv9):
Chromosome 16 (position 31239214)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29076403
GRCz11 16 29011026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAATGTGGGCTCTGCAATTGTTTTGACAATGTAATGTTATTTTCTA[G/A]TATTACTGCCAGAATCATGTGGTTCCTCCTTTGCCGGTGGTGTGCAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link