zgc:77713

Ensembl ID:
ENSDARG00000005799
ZFIN ID:
ZDB-GENE-040426-22
Description:
hypothetical protein LOC402894 [Source:RefSeq peptide;Acc:NP_991165]
Human Orthologue:
C4orf34
Human Description:
chromosome 4 open reading frame 34 [Source:HGNC Symbol;Acc:27321]
Mouse Orthologue:
1110003E01Rik
Mouse Description:
RIKEN cDNA 1110003E01 gene Gene [Source:MGI Symbol;Acc:MGI:1915802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16849 Nonsense Available for shipment Available now
sa17683 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008201   None 103 1 5
ENSDART00000137567 Nonsense 18 142 1 5

The following transcripts of ENSDARG00000005799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22082268)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22617435
GRCz11 1 23308174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGCACTGGGYTTKGTCTGTCCAACCGGAGTCTCTCAAGGATCGATA[T/G]AAACATATCAGAGCTGCTTANNNNAAGYGAAKGCTTTTAAATCTCTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008201   None 103 1 5
ENSDART00000137567 Nonsense 28 142 1 5

The following transcripts of ENSDARG00000005799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22082240)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22617407
GRCz11 1 23308146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGTCTCTCAAGGATCGATAKAAACATATCAGAGCTGCTTANNNNAAG[C/T]GAAKGCTTTTAAATCTCTTCGAGTGAGTTGTCCAAATCATTGGTAAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link