si:dkey-72g22.1

Ensembl ID:
ENSDARG00000005749
ZFIN ID:
ZDB-GENE-060503-645
Description:
cullin-associated and neddylation-dissociated 1 [Source:RefSeq peptide;Acc:NP_001103988]
Human Orthologue:
CAND2
Human Description:
cullin-associated and neddylation-dissociated 2 (putative) [Source:HGNC Symbol;Acc:30689]
Mouse Orthologue:
Cand2
Mouse Description:
cullin-associated and neddylation-dissociated 2 (putative) Gene [Source:MGI Symbol;Acc:MGI:1914338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37554 Nonsense Available for shipment Available now
sa24204 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022445 Nonsense 611 1231 10 15
Genomic Location (Zv9):
Chromosome 22 (position 33738806)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31100344
GRCz11 22 31049539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGAGTCATCTGGGCGACCACCTTGGTGCTGACTTACAGCCTACCTTG[C/T]AGATATTTCTGGAAAGGCTTAAAAATGAAATCACCAGGCTTATCGCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022445 Nonsense 755 1231 10 15
Genomic Location (Zv9):
Chromosome 22 (position 33738374)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31099912
GRCz11 22 31049107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAGTCCATTCTCCACTGCTACAAGGAGGTGCTCTTAATTCAATCCTA[C/T]AATTCTTCCAGGTTCTTGTAGCAACAAAGGCTAACAACATGGGATACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link