
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gpm6ba
- Ensembl ID:
- ENSDARG00000005739
- ZFIN ID:
- ZDB-GENE-030710-9
- Description:
- glycoprotein M6Ba [Source:RefSeq peptide;Acc:NP_982251]
- Human Orthologue:
- GPM6B
- Human Description:
- glycoprotein M6B [Source:HGNC Symbol;Acc:4461]
- Mouse Orthologue:
- Gpm6b
- Mouse Description:
- glycoprotein m6b Gene [Source:MGI Symbol;Acc:MGI:107672]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11828 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11828
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019770 | Nonsense | 192 | 289 | 4 | 7 |
ENSDART00000101911 | Nonsense | 163 | 260 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 1 (position 27895549)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28161107 GRCz11 1 28964939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTGCCAATCTCACCTCTGTGGACAACATCTGTGTTGATGTGCGGCAGTA[T/A]GGTAAACACACTRACCACCCTTTTMTGTGAATTCTTTGATGTTATTGAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: