zgc:101777

Ensembl ID:
ENSDARG00000005679
ZFIN ID:
ZDB-GENE-041114-105
Description:
Cdc42-interacting protein 4 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5U3Q6]
Human Orthologue:
TRIP10
Human Description:
thyroid hormone receptor interactor 10 [Source:HGNC Symbol;Acc:12304]
Mouse Orthologue:
Trip10
Mouse Description:
thyroid hormone receptor interactor 10 Gene [Source:MGI Symbol;Acc:MGI:2146901]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33322 Nonsense Mutation detected in F1 DNA During 2018
sa10290 Nonsense Available for shipment Available now
sa8614 Nonsense Mutation detected in F1 DNA During 2018
sa12704 Nonsense Available for shipment Available now
sa20149 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 35 542 2 17
ENSDART00000124215 Nonsense 35 592 2 15
Genomic Location (Zv9):
Chromosome 3 (position 55326347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54220163
GRCz11 3 54474826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGTCTGGCCTGGACCTGGTGGACAAATACATGAAGTTTGTAAAGGAG[C/T]GAACAGACATCGAACAGAATTATGCCAAGCAGCTAAGGTAAGATCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 42 542 2 17
ENSDART00000124215 Nonsense 42 592 2 15
Genomic Location (Zv9):
Chromosome 3 (position 55326324)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54220140
GRCz11 3 54474803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAATACATGAAGTTTGTAAAGGAGCGAACAGACATCGAACAGAATTA[T/A]GCCAAGCAGCTAAGGTAAGATCTCCTTATATNNNATSNNNTAGGCAATCTGGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
Genomic Location (Zv9):
Chromosome 3 (position 55307193)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54201009
GRCz11 3 54455672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/T]AGGACATGRATGAAMGGCGTATTAAGAAGATGGCACAGGGCTACATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
Genomic Location (Zv9):
Chromosome 3 (position 55307193)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54201009
GRCz11 3 54455672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/A]AGGACATGRATGAAMGGCGTATTAAGAAGATGGCACAGGGCTACATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Essential Splice Site 368 542 13 17
ENSDART00000124215 Essential Splice Site 418 592 11 15
Genomic Location (Zv9):
Chromosome 3 (position 55292759)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54186575
GRCz11 3 54441238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGATCGACGACATGAGCAAGGAGCTGCAGAAGGAAATGGATCAGAGG[T/C]GAGTCTTTCCTGCAGCGCTCCACCACAGGGTTCCCATGGGGTCAGGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link