nek2

Ensembl ID:
ENSDARG00000005619
ZFIN ID:
ZDB-GENE-040426-752
Description:
serine/threonine-protein kinase Nek2 [Source:RefSeq peptide;Acc:NP_957344]
Human Orthologue:
NEK2
Human Description:
NIMA (never in mitosis gene a)-related kinase 2 [Source:HGNC Symbol;Acc:7745]
Mouse Orthologue:
Nek2
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 2 Gene [Source:MGI Symbol;Acc:MGI:109359]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6622 Nonsense Mutation detected in F1 DNA During 2018
sa14846 Nonsense Mutation detected in F1 DNA During 2018
sa36991 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003248 Nonsense 234 440 6 10
Genomic Location (Zv9):
Chromosome 20 (position 13801842)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13991088
GRCz11 20 13887068
KASP Assay ID:
554-5231.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATACAAYCAGACAGAGCTGGCTCGAAAAATCAGWGAAGGCAGATTT[C/T]GAAGAATCCCATACCGATACTCGGATGAGCTAAACRCACTGCTTTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003248 Nonsense 254 440 6 10
Genomic Location (Zv9):
Chromosome 20 (position 13801903)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13991149
GRCz11 20 13887129
KASP Assay ID:
1641-0500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACCGATACTCGGATGAGCTAAACRCACTGCTTTCAAAAATGCTCAACT[T/G]AAAGGTAAATATTGGTGAGGGTNAAAGTATGCAACAGTCTGRAAGTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003248 Nonsense 324 440 7 10
Genomic Location (Zv9):
Chromosome 20 (position 13804658)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13993904
GRCz11 20 13889884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGCTTAAAGAGCAGATTCTCCGAGAGCGAGAGCAGGCCCTCAAAGAG[C/T]GAGAGCAGCGGCTAGAGCGTAAGCACACTGTTGTTGGCCTTCTGAAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link