aph1b

Ensembl ID:
ENSDARG00000005612
ZFIN ID:
ZDB-GENE-031118-31
Description:
Gamma-secretase subunit Aph-1b [Source:UniProtKB/Swiss-Prot;Acc:Q8JHE9]
Human Orthologue:
APH1B
Human Description:
anterior pharynx defective 1 homolog B (C. elegans) [Source:HGNC Symbol;Acc:24080]
Mouse Orthologues:
Aph1b, Aph1c
Mouse Descriptions:
anterior pharynx defective 1b homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3522097]
anterior pharynx defective 1c homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915568]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38614 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008096 Nonsense 183 258 5 6

The following transcripts of ENSDARG00000005612 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 30519194)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28911536
GRCz11 7 29182686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTATCCTGCTCCACATGTTCTGGGGGGTGGTTTTCTTCGAGGCCTGT[G/T]AGCGTCAGAGATGGTGGGCTCTCGGAGCCGTGGTCGCCAGTCATCTAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link