
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mtf2
- Ensembl ID:
- ENSDARG00000005590
- ZFIN ID:
- ZDB-GENE-060512-94
- Description:
- metal-response element-binding transcription factor 2 [Source:RefSeq peptide;Acc:NP_001038729]
- Human Orthologue:
- MTF2
- Human Description:
- metal response element binding transcription factor 2 [Source:HGNC Symbol;Acc:29535]
- Mouse Orthologue:
- Mtf2
- Mouse Description:
- metal response element binding transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:105050]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30814 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32851 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30814
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100634 | Nonsense | 32 | 285 | 2 | 10 |
ENSDART00000122709 | Nonsense | 32 | 605 | 2 | 15 |
The following transcripts of ENSDARG00000005590 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 10422981)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 10848077 GRCz11 2 10631676 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTCCAAATCGCCAACACAAGTCCCCTGTGTCCTTGCCCCGATTTCCCT[T/A]GAAAGATGGGCTGACCGACACGACAAAGCTTGCTGGCAAGTTTGAGGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32851
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100634 | Nonsense | 223 | 285 | 7 | 10 |
ENSDART00000122709 | Nonsense | 223 | 605 | 7 | 15 |
The following transcripts of ENSDARG00000005590 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 10407617)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 10832713 GRCz11 2 10616312 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTTTCCCACAGCTGGTATCTGAAGATGTTACAGTGTAATAAGTGTAAA[C/T]AGTGGTTTCATGAAGCTTGTATCCAGTGTTTTCAGAAGCCAATGCTCTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: