zgc:158317

Ensembl ID:
ENSDARG00000005586
ZFIN ID:
ZDB-GENE-070112-1992
Description:
zinc finger and BTB domain-containing protein 20 [Source:RefSeq peptide;Acc:NP_001074073]
Human Orthologue:
ZBTB20
Human Description:
zinc finger and BTB domain containing 20 [Source:HGNC Symbol;Acc:13503]
Mouse Orthologue:
Zbtb20
Mouse Description:
zinc finger and BTB domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1929213]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14334 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013605 Nonsense 368 687 3 4
ENSDART00000133753   None 180 None 3
Genomic Location (Zv9):
Chromosome 5 (position 70539161)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66864305
GRCz11 5 67542674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCGAGCGGAAACGGTCCTACTCAAGAAAGTGGYGAGATCGGGATCCAB[C/T]AAGCCAATCTAACAGCTCCCCAAGTGATGCCCGGTGGGCCGTACCTGYGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Gastric cancer: A genome-wide association study identifies new susceptibility loci for non-cardia gastric cancer at 3q13.31 and 5p13.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link