hnrnph1l

Ensembl ID:
ENSDARG00000005551
ZFIN ID:
ZDB-GENE-030131-275
Description:
heterogeneous nuclear ribonucleoprotein H1, like [Source:RefSeq peptide;Acc:NP_997754]
Human Orthologues:
HNRNPH1, HNRNPH2
Human Descriptions:
heterogeneous nuclear ribonucleoprotein H1 (H) [Source:HGNC Symbol;Acc:5041]
heterogeneous nuclear ribonucleoprotein H2 (H') [Source:HGNC Symbol;Acc:5042]
Mouse Orthologues:
Hnrnph1, Hnrnph2
Mouse Descriptions:
heterogeneous nuclear ribonucleoprotein H1 Gene [Source:MGI Symbol;Acc:MGI:1891925]
heterogeneous nuclear ribonucleoprotein H2 Gene [Source:MGI Symbol;Acc:MGI:1201779]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45741 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015636 Nonsense 318 407 8 11

The following transcripts of ENSDARG00000005551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28917996)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30137240
GRCz11 21 30173935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACATGAAGATGCAGTGGCTGCAATGTCAAAGGACAAGGCCAACATG[C/T]GTAAGTTCGGGGTATCCTGACTAGATTGCCTAAATCATGGGTGCCAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link