zgc:113358

Ensembl ID:
ENSDARG00000005526
ZFIN IDs:
ZDB-GENE-050327-30, ZDB-GENE-050327-30
Description:
hypothetical protein LOC541504 [Source:RefSeq peptide;Acc:NP_001014339]
Human Orthologue:
IGFN1
Human Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Mouse Orthologue:
Igfn1
Mouse Description:
immunoglobulin-like and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:304

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20806 Nonsense Available for shipment Available now
sa9188 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40783 Nonsense Mutation detected in F1 DNA During 2018
sa16347 Nonsense Available for shipment Available now
sa40782 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037875 Nonsense 63 534 4 14
ENSDART00000110113 Nonsense 73 1533 4 24
ENSDART00000129301 Nonsense 63 534 4 15
Genomic Location (Zv9):
Chromosome 6 (position 46852975)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46913909
GRCz11 6 46915791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGACTAACAATTTCCAATTTCATACAACAGGAAAGTTGGCCATTTTT[A/T]AAGCGAAAGTGACTGGAAGCCCAACACCTACTGTAACCTGGCGTAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037875 Essential Splice Site 103 534 4 14
ENSDART00000110113 Essential Splice Site 113 1533 4 24
ENSDART00000129301 Essential Splice Site 103 534 4 15
Genomic Location (Zv9):
Chromosome 6 (position 46852851)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46913785
GRCz11 6 46915667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTTTCAGAGCAAATTTGACCCTACAACCAATGAACACACTTTGGAGG[T/A]AAGCACAGGCTTAAATTAAACTACTACTGAACAATTAGGATTAAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037875   None 534 None 14
ENSDART00000110113 Nonsense 947 1533 16 24
ENSDART00000129301   None 534 None 15
Genomic Location (Zv9):
Chromosome 6 (position 46831015)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46891949
GRCz11 6 46893831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCCCTCTTGGACCTCTGGAGATTGTTGAAGCATCTTCCAACTGCGTC[G/T]AGATCAAGTGGAGACCACCAAAAGACGATGGCGGTTGCCCTATTAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037875   None 534 None 14
ENSDART00000110113 Nonsense 1082 1533 17 24
ENSDART00000129301   None 534 None 15
Genomic Location (Zv9):
Chromosome 6 (position 46828244)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46889178
GRCz11 6 46891060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARAAACGCAAGAAGGGCARCAACYTGTGGAGCCAYGTCAATCCACCAGAT[C/T]AACCAATCCAAGGTATGTCTCACAYTTTTTTWGACAAGCTTTACAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037875   None 534 None 14
ENSDART00000110113 Essential Splice Site 1085 1533 17 24
ENSDART00000129301   None 534 None 15
Genomic Location (Zv9):
Chromosome 6 (position 46828231)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46889165
GRCz11 6 46891047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCAGCAACTTGTGGAGCCACGTCAATCCACCAGATCAACCAATCCAAG[G/A]TATGTCTCACATTTTTTTAGACAAGCTTTACAATGAAATTCTGTCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link