zgc:66125

Ensembl ID:
ENSDARG00000005462
ZFIN ID:
ZDB-GENE-040426-1545
Description:
kinesin family member 4 [Source:RefSeq peptide;Acc:NP_957117]
Human Orthologues:
KIF4A, KIF4B
Human Descriptions:
kinesin family member 4A [Source:HGNC Symbol;Acc:13339]
kinesin family member 4B [Source:HGNC Symbol;Acc:6322]
Mouse Orthologues:
AC122507.1, Kif4
Mouse Descriptions:
kinesin family member 4 Gene [Source:MGI Symbol;Acc:MGI:108389]
kinesin family member 4B (Kif4b), non-coding RNA [Source:RefSeq DNA;Acc:NR_033653]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10251 Nonsense Available for shipment Available now
sa37382 Nonsense Available for shipment Available now
sa12877 Nonsense Available for shipment Available now
sa43726 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026178 Nonsense 32 1248 2 31
Genomic Location (Zv9):
Chromosome 21 (position 43307213)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44746871
GRCz11 21 44771117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGCAGACCTCTGGTGCCCAAAGAGATCAAWGAGGGATGCCAGTGCTG[T/A]CTTAATTTTGTACCCAGTGAACCTCAGGTCTGTGTGTGTCAGRTCATTSC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026178 Nonsense 76 1248 3 31
Genomic Location (Zv9):
Chromosome 21 (position 43306991)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44746649
GRCz11 21 44770895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGAACAGGAGGAAGTTTTCAACACTGCGGTGTCTCCTTTATTATCT[G/T]GACTTTTTAAAGGTTTGTAAGGCCATGTCCACACTAATGCGTTTTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026178 Nonsense 103 1248 4 31
Genomic Location (Zv9):
Chromosome 21 (position 43305421)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44745079
GRCz11 21 44769325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTATGGGCAGACGGGRTCAGGCAAGACGTTCTCTATGGGCGGCACTTA[C/A]ACRTCCGAACAGGAGAACGAGCCCACGGTCGGGGTGATCCCGMGAGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026178 Nonsense 406 1248 11 31
Genomic Location (Zv9):
Chromosome 21 (position 43297538)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44737196
GRCz11 21 44761442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCCTGGAGCAGAACCGCAGTCTGCAGGATCAGAACAGCAAACTGAGC[C/T]GAGAGCTGAGCGAGTCTGTGGGACAGACGGCTGCCATGTTTGAAAGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link