zgc:152651

Ensembl ID:
ENSDARG00000005448
ZFIN ID:
ZDB-GENE-060929-120
Description:
methionyl-tRNA formyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001071010]
Human Orthologue:
MTFMT
Human Description:
mitochondrial methionyl-tRNA formyltransferase [Source:HGNC Symbol;Acc:29666]
Mouse Orthologue:
Mtfmt
Mouse Description:
mitochondrial methionyl-tRNA formyltransferase Gene [Source:MGI Symbol;Acc:MGI:1916856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41024 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053814 Splice Site, Nonsense 75 390 1 9
Genomic Location (Zv9):
Chromosome 7 (position 54208671)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52478521
GRCz11 7 52753591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAGTGATGATTTTGCTCTGGAGTCACTGAAGCGGCTTCATTTGTCT[C/T]GGTAATGACATCCAGGATGTTATTGTATTATTGTCCGTTATGACCTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link