
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grin3b
- Ensembl ID:
- ENSDARG00000005364
- ZFIN ID:
- ZDB-GENE-070912-354
- Human Orthologue:
- GRIN3B
- Human Description:
- glutamate receptor, ionotropic, N-methyl-D-aspartate 3B [Source:HGNC Symbol;Acc:16768]
- Mouse Orthologue:
- Grin3b
- Mouse Description:
- glutamate receptor, ionotropic, NMDA3B Gene [Source:MGI Symbol;Acc:MGI:2150393]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25813 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38334 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25813
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058111 | Nonsense | 126 | 1118 | 1 | 9 |
ENSDART00000147354 | Nonsense | 94 | 912 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 26209185)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 26405381 GRCz11 2 26061015 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGAGTCTCGGCTGTGCTCGCGTTCCCCCAGAGCCACGAGGAGCTCATA[C/T]AAGTGGAGTTCATGTCCTCGTTTTTGGAAATACCCTTCATCAGCATCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38334
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058111 | Essential Splice Site | 816 | 1118 | 5 | 9 |
ENSDART00000147354 | Essential Splice Site | 784 | 912 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 26275296)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 26471492 GRCz11 2 26127126 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACGCAGACTGCAAACTCCTGACTGTAGGAAAACCGTTTGCTATTGAAGG[T/G]AAGGTCCGCTGTGCCACTGAAACATATTGCTAACACCTCAGGCTATGCCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: