slc22a4

Ensembl ID:
ENSDARG00000005335
ZFIN ID:
ZDB-GENE-040426-1517
Description:
solute carrier family 22 member 4 [Source:RefSeq peptide;Acc:NP_957143]
Human Orthologues:
SLC22A4, SLC22A5
Human Descriptions:
solute carrier family 22 (organic cation/carnitine transporter), member 5 [Source:HGNC Symbol;Acc:10
solute carrier family 22 (organic cation/ergothioneine transporter), member 4 [Source:HGNC Symbol;Ac
Mouse Orthologues:
Slc22a21, Slc22a4, Slc22a5
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 21 Gene [Source:MGI Symbol;Acc:MGI:192
solute carrier family 22 (organic cation transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1353
solute carrier family 22 (organic cation transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1329

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24040 Essential Splice Site Available for shipment Available now
sa19273 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024342 Essential Splice Site 483 553 8 10

The following transcripts of ENSDARG00000005335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44232937)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45864278
GRCz11 21 45902625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGACGGCCCGCATCGGCAGCATCATCTCGCCCTTCATCATATACCTGG[G/A]TATCTTCTTCTGCTGCGGTATTAGCATTACCGCTGATGTTAATGCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024342 Nonsense 528 553 9 10

The following transcripts of ENSDARG00000005335 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44233151)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45864492
GRCz11 21 45902839
KASP Assay ID:
2261-6133.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCAAAGGAAAGGTTCTGCCAGAGACCATCGCTCAGATGCAGAGCGTA[C/T]GAGGGTAAATATACCGGCCTGCTGCAGTAAACTACTGTAAACACTGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: A large-scale, consortium-based genomewide association study of asthma. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link