zgc:85882

Ensembl ID:
ENSDARG00000005284
ZFIN ID:
ZDB-GENE-040426-2440
Description:
F-box only protein 37 [Source:RefSeq peptide;Acc:NP_998107]
Human Orthologue:
FBXL15
Human Description:
F-box and leucine-rich repeat protein 15 [Source:HGNC Symbol;Acc:28155]
Mouse Orthologue:
Fbxl15
Mouse Description:
F-box and leucine-rich repeat protein 15 Gene [Source:MGI Symbol;Acc:MGI:1915681]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124455 Nonsense 271 310 4 5
Genomic Location (Zv9):
Chromosome 12 (position 46616656)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 45502670
GRCz11 12 45664188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAAACTGCAGTCCCTAAAAGTCAACCACTGTCACAATGTGACGGAGT[C/A]GAGTCTGGGTGTTCTGCGGCGGAGGAACGTAGAGATYGATGTGGAGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link