
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rad52
- Ensembl ID:
- ENSDARG00000005274
- ZFIN IDs:
- ZDB-GENE-050731-10, ZDB-GENE-050731-10
- Description:
- RAD52 homolog [Source:RefSeq peptide;Acc:NP_001019622]
- Human Orthologue:
- RAD52
- Human Description:
- RAD52 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:9824]
- Mouse Orthologue:
- Rad52
- Mouse Description:
- RAD52 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101949]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44297 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38067 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44297
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017488 | Nonsense | 109 | 409 | 4 | 10 |
ENSDART00000079012 | Nonsense | 109 | 434 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 25 (position 21772807)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21004683 GRCz11 25 21102337 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATCAATGGGAAGTTTTACGTTGGAGTCAGTGCTTTCATTAAGGTCCAGT[T/G]AAAGGTAAGAGCTCTGACAATACAGAAGTACAGAGTTGTGAGTAGCATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38067
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017488 | Nonsense | 129 | 409 | 5 | 10 |
ENSDART00000079012 | Nonsense | 129 | 434 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 25 (position 21772938)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21004814 GRCz11 25 21102468 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCATTTCATGAGGATGTAGGATATGGGGTCAGCGAAGGCCTCAAATCC[A/T]AAGCTCTGTCCCTGGAAAAAGCAAGAAAAGAAGCTGTCACAGATGGATTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lung cancer: Influence of common genetic variation on lung cancer risk: meta-analysis of 14 900 cases and 29 485 controls. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: