
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rpe
- Ensembl ID:
- ENSDARG00000005251
- ZFIN ID:
- ZDB-GENE-030131-6837
- Description:
- ribulose-phosphate 3-epimerase [Source:RefSeq peptide;Acc:NP_958469]
- Human Orthologue:
- RPE
- Human Description:
- ribulose-5-phosphate-3-epimerase [Source:HGNC Symbol;Acc:10293]
- Mouse Orthologue:
- Rpe
- Mouse Description:
- ribulose-5-phosphate-3-epimerase Gene [Source:MGI Symbol;Acc:MGI:1913896]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21487 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21487
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021218 | Nonsense | 57 | 228 | 2 | 6 |
ENSDART00000144163 | Nonsense | 5 | 137 | 1 | 5 |
The following transcripts of ENSDARG00000005251 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 25064000)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 24219786 GRCz11 9 24030655 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGCATTTTGTTCCAAACATCACATTTGGGCATCCAATGGTGGAATGTT[T/A]ACGAAGCTGTATCGGACCTGATCCATTTTTTGGTGAGTTCCAGTCTTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: