desmb

Ensembl ID:
ENSDARG00000005221
ZFIN ID:
ZDB-GENE-061027-102
Description:
desmin [Source:RefSeq peptide;Acc:NP_001070920]
Human Orthologue:
DES
Human Description:
desmin [Source:HGNC Symbol;Acc:2770]
Mouse Orthologue:
Des
Mouse Description:
desmin Gene [Source:MGI Symbol;Acc:MGI:94885]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45246 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065356 Nonsense 70 473 1 9
Genomic Location (Zv9):
Chromosome 6 (position 13802060)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13762022
GRCz11 6 13891459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCATCCACTTCTTCTCCTGGATTCTCCGGTTATCGAGCGTCCTCCTA[C/A]AGCATGCCCAACTTGTCTGCAGGCTATACTCGCTCTTATGGTGGGATGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link