zgc:158328

Ensembl ID:
ENSDARG00000005216
ZFIN ID:
ZDB-GENE-070112-1202
Description:
hypothetical protein LOC567225 [Source:RefSeq peptide;Acc:NP_001073658]
Mouse Orthologue:
Egfem1
Mouse Description:
EGF-like and EMI domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1922990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066737 Nonsense 278 802 8 19
Genomic Location (Zv9):
Chromosome 15 (position 34596297)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35442073
GRCz11 15 35300042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGGCGGRTGTTCTCAAATCTGCACTGATGTGAATGGACTGGTTCAGTG[C/A]AGCTGCAGAACAGGATTCACATTGGCAAATGACCTCAGGAGATGTGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link