sp4

Ensembl ID:
ENSDARG00000005186
ZFIN ID:
ZDB-GENE-031202-3
Description:
transcription factor Sp4 [Source:RefSeq peptide;Acc:NP_956418]
Human Orthologue:
SP4
Human Description:
Sp4 transcription factor [Source:HGNC Symbol;Acc:11209]
Mouse Orthologue:
Sp4
Mouse Description:
trans-acting transcription factor 4 Gene [Source:MGI Symbol;Acc:MGI:107595]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29124 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097528 Nonsense 34 714 3 6
Genomic Location (Zv9):
Chromosome 19 (position 2973711)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2619689
GRCz11 19 2550573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGACACTGACATCTCGCTGTTTGTGTGTGTGTGTGTGTAGGATGCA[C/T]AGCCGTCTCCTCTTGCATTGCTTGCAGCGACGTGCAGTAAAATCGGAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link