limk2

Ensembl ID:
ENSDARG00000005104
ZFIN ID:
ZDB-GENE-040718-398
Description:
LIM domain kinase 2 [Source:RefSeq peptide;Acc:NP_001002651]
Human Orthologue:
LIMK2
Human Description:
LIM domain kinase 2 [Source:HGNC Symbol;Acc:6614]
Mouse Orthologue:
Limk2
Mouse Description:
LIM motif-containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1197517]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33573 Nonsense Mutation detected in F1 DNA During 2018
sa45196 Nonsense Mutation detected in F1 DNA During 2018
sa16581 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093185 Nonsense 203 651 6 16
ENSDART00000142894 Nonsense 213 219 7 7

The following transcripts of ENSDARG00000005104 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 22629295)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20342167
GRCz11 5 20845967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGATGCATATTAGTCCTGAGGTTCGGAATGCCATCCATGTTGGGGAC[C/T]GAATCCTGGAGATCAATGGACTCCCAGTGACATCCCTGATAGAGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093185 Nonsense 511 651 13 16
ENSDART00000142894   None 219 None 7

The following transcripts of ENSDARG00000005104 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 22639443)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20352315
GRCz11 5 20856115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTAATAAGAAAAGGCTGTTTAGACGCATTGATCGCAAGAAACGCTA[C/A]ACGGTGGTGGGGAACCCTTACTGGATGGCCCCAGAGATGCTCAATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093185 Nonsense 579 651 15 16
ENSDART00000142894   None 219 None 7

The following transcripts of ENSDARG00000005104 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 22643005)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20355877
GRCz11 5 20859677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGCTGAATGTGCGAACSTTCATYGAGAAGTTTCTTCCTGAGCACTG[T/A]CCTCCTGCTTTCTTTGCATTGGCTGTGGCCTGTTGTGACCTCACTCCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link