Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fkbp9
- Ensembl ID:
- ENSDARG00000005023
- ZFIN ID:
- ZDB-GENE-040801-23
- Description:
- peptidyl-prolyl cis-trans isomerase FKBP9 [Source:RefSeq peptide;Acc:NP_001003520]
- Human Orthologue:
- FKBP9
- Human Description:
- FK506 binding protein 9, 63 kDa [Source:HGNC Symbol;Acc:3725]
- Mouse Orthologue:
- Fkbp9
- Mouse Description:
- FK506 binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:1350921]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa23588 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23588
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000004392 | Essential Splice Site | 179 | 564 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 44205724)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 43033492 GRCz11 19 42602929 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTACCACTACAATGGCACTCTGCTTGATGGCACGCTGTTCGACTCCAG[G/A]TGAGATCATTTGTGTGGACCTAATAAAACAACATAAATAGTTTTTATTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
