zgc:66430

Ensembl ID:
ENSDARG00000005015
ZFIN ID:
ZDB-GENE-030131-9158
Description:
hypothetical protein LOC337214 [Source:RefSeq peptide;Acc:NP_956349]
Human Orthologues:
TSPY10, TSPY2, TSPY3, TSPY4, TSPY8, TSPYL1, TSPYL2, TSPYL4, TSPYL5, TSPYL6
Human Descriptions:
testis specific protein, Y-linked 10 [Source:HGNC Symbol;Acc:37473]
testis specific protein, Y-linked 2 [Source:HGNC Symbol;Acc:23924]
testis specific protein, Y-linked 3 [Source:HGNC Symbol;Acc:33876]
testis specific protein, Y-linked 4 [Source:HGNC Symbol;Acc:37287]
testis specific protein, Y-linked 8 [Source:HGNC Symbol;Acc:37471]
TSPY-like 1 [Source:HGNC Symbol;Acc:12382]
TSPY-like 2 [Source:HGNC Symbol;Acc:24358]
TSPY-like 4 [Source:HGNC Symbol;Acc:21559]
TSPY-like 5 [Source:HGNC Symbol;Acc:29367]
TSPY-like 6 [Source:HGNC Symbol;Acc:14521]
Mouse Orthologues:
Tspyl1, Tspyl2, Tspyl3, Tspyl4, Tspyl5
Mouse Descriptions:
testis-specific protein, Y-encoded-like 1 Gene [Source:MGI Symbol;Acc:MGI:1298395]
testis-specific protein, Y-encoded-like 5 Gene [Source:MGI Symbol;Acc:MGI:2442458]
TSPY-like 2 Gene [Source:MGI Symbol;Acc:MGI:106244]
TSPY-like 3 Gene [Source:MGI Symbol;Acc:MGI:2139328]
TSPY-like 4 Gene [Source:MGI Symbol;Acc:MGI:106393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41218 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17268 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007482 Essential Splice Site 346 519 4 7
Genomic Location (Zv9):
Chromosome 8 (position 26566113)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25694031
GRCz11 8 25713170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATATACACACAACAATAGTAATGCGATAACATCTGTATTTATTCCTC[A/T]GGGTCTCCAGTGTCCTTCTCAAACCCAATATTGTGGCACAGAGGGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007482 Nonsense 371 519 4 7
Genomic Location (Zv9):
Chromosome 8 (position 26566037)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25693955
GRCz11 8 25713094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATTGTGGCACAGAGGGCAGAATCTGGTTGGGAGTGGAGAACCACGT[C/T]GAACATCKCAGGGGGTCTATCAGAGCTTCTTCCATTGGTTYAGTGACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link