si:dkeyp-2e4.8

Ensembl ID:
ENSDARG00000005010
ZFIN ID:
ZDB-GENE-061207-81
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:A2CEY3]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42291 Nonsense Mutation detected in F1 DNA During 2018
sa9833 Nonsense Available for shipment Available now
sa15901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074773   None 699 None 7
ENSDART00000131673 Nonsense 72 253 1 1
Genomic Location (Zv9):
Chromosome 13 (position 45438592)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44682091
GRCz11 13 44818995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACACTGAACCGGAAGCATCCGTCTCCAAATCTGGCAAACGGAAAAAA[C/T]GAAGCAGAAAAACTCCTGGTAAAAAGTACGTGTGTAAACTGTGTGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074773 Nonsense 366 699 6 7
ENSDART00000131673 Nonsense 90 253 1 1
Genomic Location (Zv9):
Chromosome 13 (position 45438536)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44682035
GRCz11 13 44818939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARAAAAACTCCTGGTAAAAAGTAYGTGTGTAAACTGTGTGGCAYTGAGTA[T/A]CGCCACAGCTCAAACCTAGGGACGCACATGCGAATACACACAGGAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074773 Nonsense 625 699 7 7
ENSDART00000131673   None 253 None 1
Genomic Location (Zv9):
Chromosome 13 (position 45432342)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44675841
GRCz11 13 44812745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATTTATACAAACACAGAGGAGARAGGCCGTTCGCCTGCTCYCACTG[C/A]GACAAAACCTTCTTCAGTCAAACCAATCTGAACAGACACCACAAGGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link