bmp5

Ensembl ID:
ENSDARG00000004965
ZFIN ID:
ZDB-GENE-040426-1413
Description:
bone morphogenetic protein 5 [Source:RefSeq peptide;Acc:NP_957345]
Human Orthologue:
BMP5
Human Description:
bone morphogenetic protein 5 [Source:HGNC Symbol;Acc:1072]
Mouse Orthologue:
Bmp5
Mouse Description:
bone morphogenetic protein 5 Gene [Source:MGI Symbol;Acc:MGI:88181]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39497 Nonsense Mutation detected in F1 DNA During 2018
sa45870 Nonsense Mutation detected in F1 DNA During 2018
sa30324 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019239 Nonsense 108 446 1 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 27304)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1742010
GRCz11 13 1873301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTCGCGGGGAAAGTGCGTAAAAGCGCGCCCGGAGCTCCGCACGGATA[T/A]TCGCGCGCGCCACCGCGTGTTCCGCAGCCGCAACACTCCCGCGCCGCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019239 Nonsense 286 446 9 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 46728)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1768231
GRCz11 13 1899522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGAAGCATCAACATGAAATCTGCTGGCATCATCGGCAGGAACGGACCT[C/T]AGTCCAAACAGCCGTTCCTGGTGGCTTTTTTCAAAGCCAGCGAGGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019239 Nonsense 312 446 9 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 46806)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1768309
GRCz11 13 1899600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAAGCCAGCGAGGTTTTGCTTCGTTCTGTGAGAGCCACGGGAAGC[A/T]AGAAGAAGAGCCACAACAGAAACAAAAGCAAAACACAAGCGAAATCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link