Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grna
- Ensembl ID:
- ENSDARG00000004954
- ZFIN ID:
- ZDB-GENE-030131-8434
- Description:
- granulin-a [Source:RefSeq peptide;Acc:NP_001001949]
- Human Orthologue:
- GRN
- Human Description:
- granulin [Source:HGNC Symbol;Acc:4601]
- Mouse Orthologue:
- Grn
- Mouse Description:
- granulin Gene [Source:MGI Symbol;Acc:MGI:95832]
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa33188 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa38396 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa6034 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa20026 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33188
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103523 | Essential Splice Site | 92 | 873 | 3 | 19 |
| ENSDART00000137973 | Essential Splice Site | 92 | 1049 | 4 | 24 |
| ENSDART00000147732 | Essential Splice Site | 92 | 873 | 4 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 30084140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 29802179 GRCz11 3 29933021 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAGCCATTGGCAGACAGGACACTAGCTAAAAAGCCAGACCTTCCCAAA[G/A]TGAGACATTATATAAAGAGTGTAAGTGATAGTACTCATAGCTGATCGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38396
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103523 | Essential Splice Site | 135 | 873 | 4 | 19 |
| ENSDART00000137973 | Essential Splice Site | 135 | 1049 | 5 | 24 |
| ENSDART00000147732 | Essential Splice Site | 135 | 873 | 5 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 30083931)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 29801970 GRCz11 3 29932812 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTTGTCTGCTGATGTCTACATCATACGGCTGCTGTCCAGTAGCACAGG[T/A]AAGCGACACTATTACAGGAATATCAGCCCAAAACACCAGCTACTGCTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6034
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103523 | Nonsense | 716 | 873 | 17 | 19 |
| ENSDART00000137973 | Nonsense | 892 | 1049 | 22 | 24 |
| ENSDART00000147732 | Nonsense | 716 | 873 | 18 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 30068401)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 29786440 GRCz11 3 29917282 - KASP Assay ID:
- 554-3919.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGCACACCAGCTCCAAAGTTGGATCTCGGCGTTGTTAAATGCGATGAA[C/T]AGTCGAGTTGCTCTGCAGATTCGACCTGCTGCCTCTTGTCTAAAGAMGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20026
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103523 | Nonsense | 846 | 873 | 19 | 19 |
| ENSDART00000137973 | Nonsense | 1022 | 1049 | 24 | 24 |
| ENSDART00000147732 | Nonsense | 846 | 873 | 20 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 30066460)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 29784499 GRCz11 3 29915341 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCAACACTGCTGTCCCGCGGGGTATAAGTGTGGGCCGGGTGGCACCTG[T/A]ATTTCAGCCGGAGACTTGGACTGGAGCAACTGGGTCAACTGGAAGTTGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Intracranial volume: Common variants at 6q22 and 17q21 are associated with intracranial volume. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
