slc8a3

Ensembl ID:
ENSDARG00000004931
ZFIN ID:
ZDB-GENE-050810-1
Description:
sodium/calcium exchanger 3 [Source:RefSeq peptide;Acc:NP_001116728]
Human Orthologue:
SLC8A3
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 3 [Source:HGNC Symbol;Acc:11070]
Mouse Orthologue:
Slc8a3
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:107976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35553 Essential Splice Site Available for shipment Available now
sa31946 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100204 Essential Splice Site 793 917 5 6
Genomic Location (Zv9):
Chromosome 13 (position 36602415)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36074984
GRCz11 13 36200816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTGTCACTGCTGTGGTGTTTGTAGCTCTGGGAACATCCATTCCTGG[T/C]GAGTATTGCTTGCTTATATAATGCATTTTTGCAAATATCTTTTAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100204 Nonsense 837 917 6 6
Genomic Location (Zv9):
Chromosome 13 (position 36598826)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36071395
GRCz11 13 36197227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTTTTCCTGGGAATCGGCGTGGCCTGGTCAGTGGCTGCCATCTACTG[G/A]CACATGCAGGGTCGTGCGTTCGAGGTGCCTGCAGGTTCCCTTGCATTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link