
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TMC6 (1 of 2)
- Ensembl ID:
- ENSDARG00000004875
- Description:
- transmembrane channel-like 6 [Source:HGNC Symbol;Acc:18021]
- Human Orthologue:
- TMC6
- Human Description:
- transmembrane channel-like 6 [Source:HGNC Symbol;Acc:18021]
- Mouse Orthologue:
- Tmc6
- Mouse Description:
- transmembrane channel-like gene family 6 Gene [Source:MGI Symbol;Acc:MGI:1098686]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6225 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6225
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037819 | Nonsense | 509 | 549 | 16 | 18 |
- Genomic Location (Zv9):
- Chromosome 11 (position 46411876)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 44828513 GRCz11 11 45242907 - KASP Assay ID:
- 554-4673.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGTCAAGTGCTGGACGGCCAGAGGAAGATCATYGAACTCCTTCAGGAG[C/T]AGATYGAGAACGTGAGACTGGGAATCATGGGTAATTAAACACAATACAKT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: