zgc:64105

Ensembl ID:
ENSDARG00000004874
ZFIN ID:
ZDB-GENE-040426-1369
Description:
hypothetical protein LOC393384 [Source:RefSeq peptide;Acc:NP_956706]
Human Orthologue:
C9orf68
Human Description:
chromosome 9 open reading frame 68 [Source:HGNC Symbol;Acc:25472]
Mouse Orthologue:
4430402I18Rik
Mouse Description:
RIKEN cDNA 4430402I18 gene Gene [Source:MGI Symbol;Acc:MGI:1918036]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41082 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16328 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008421 Essential Splice Site 162 338 6 13
Genomic Location (Zv9):
Chromosome 7 (position 72201451)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69246470
GRCz11 7 69484520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAATCAGTGAAATCTCCAGCGACAATGGCTTCCTAACTCTTCCTGTG[G/T]TAAAAACAAACATAGATTTCGAAATGATCAGCTTTACTGCTTTATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008421 Nonsense 207 338 8 13
Genomic Location (Zv9):
Chromosome 7 (position 72203356)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69248375
GRCz11 7 69486425
KASP Assay ID:
2259-9816.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGTATGTTTTATTTTGTGCGCTGTAGGATCAGAGATCTTCTGGTTW[T/A]TCACCYGTCTCTGCCAGAAAGCCCAGATTTAGRAGTCTGTCACCACATCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link