zgc:171734

Ensembl ID:
ENSDARG00000004864
ZFIN ID:
ZDB-GENE-070928-26
Description:
forkhead box protein R1 [Source:RefSeq peptide;Acc:NP_001096594]
Human Orthologues:
FOXR1, FOXR2
Human Descriptions:
forkhead box R1 [Source:HGNC Symbol;Acc:29980]
forkhead box R2 [Source:HGNC Symbol;Acc:30469]
Mouse Orthologues:
Foxr1, Foxr2
Mouse Descriptions:
forkhead box R1 Gene [Source:MGI Symbol;Acc:MGI:2685961]
forkhead box R2 Gene [Source:MGI Symbol;Acc:MGI:3511682]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40575 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30620 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019561 Essential Splice Site 146 321 4 6
Genomic Location (Zv9):
Chromosome 5 (position 60151212)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58012830
GRCz11 5 58682539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAATGACAGTGTAGCTAGTCTATAATGCATCCCCACTATGTCACCTC[A/G]GCTGACAGATGAAGATGACGCTTCGTCTGTGGATGTGCCAATCTGCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019561 Essential Splice Site 235 321 4 6
Genomic Location (Zv9):
Chromosome 5 (position 60151483)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58013101
GRCz11 5 58682810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCGCAGCGGCAGTCTCAACGTTCAGCAGATCTACAACTTCACCAG[G/A]TCTCCGAGCGCTCCATACACAAACACACACATATGCTTACACATAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link