zgc:101780

Ensembl ID:
ENSDARG00000004798
ZFIN ID:
ZDB-GENE-041114-103
Description:
hypothetical protein LOC492760 [Source:RefSeq peptide;Acc:NP_001007402]
Human Orthologue:
B4GALT4
Human Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 [Source:HGNC Symbol;Acc:927]
Mouse Orthologue:
B4galt4
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44627 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022903 Nonsense 70 206 2 5
Genomic Location (Zv9):
Chromosome 5 (position 70740597)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67065741
GRCz11 5 67744110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGATCTAGTTCCTGAGAATGATCATAACTTATACATGTGCGCGAAA[C/T]AGCCGAAGCACTTAGTGGTCGGGAGGAATTCCACTGGGTACAAGTGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link