si:dkey-102m7.4

Ensembl ID:
ENSDARG00000004780
ZFIN ID:
ZDB-GENE-030131-6705
Human Orthologue:
CCDC142
Human Description:
coiled-coil domain containing 142 [Source:HGNC Symbol;Acc:25889]
Mouse Orthologue:
Ccdc142
Mouse Description:
coiled-coil domain containing 142 Gene [Source:MGI Symbol;Acc:MGI:3045292]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35674 Nonsense Mutation detected in F1 DNA During 2018
sa31978 Nonsense Available for shipment Available now
sa45511 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006181 Nonsense 192 1024 4 12
ENSDART00000144380 Nonsense 192 1024 6 14
Genomic Location (Zv9):
Chromosome 14 (position 18754423)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14548876
GRCz11 14 14854439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAACACCTGATGGACCAAAGAGCCCAGCTGCTCTTCTTCCATGAATA[C/A]GCCCGACGCACACAAATGGCCACCTGCTTTGTTGCTCAATTAGGCTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006181 Nonsense 417 1024 4 12
ENSDART00000144380 Nonsense 417 1024 6 14
Genomic Location (Zv9):
Chromosome 14 (position 18755096)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14549549
GRCz11 14 14855112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGCGAATAACCCCAAGGAACTCAAAGGTCACACTAAACTTAACAGT[C/T]GACTTTTATCATCACCCACAATAAACTTACATACAGTACAACTTGAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006181 Nonsense 670 1024 6 12
ENSDART00000144380 Nonsense 670 1024 8 14
Genomic Location (Zv9):
Chromosome 14 (position 18757221)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14551674
GRCz11 14 14857237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTATTCTTCAGCTCTTCCTACCTCTCCATACAGTTCTTCAGTTACTG[C/T]AACACCCAGACATAGAGTCAGGTACTCAACTTTACACTTTTGCCATCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link