
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-102m7.4
- Ensembl ID:
- ENSDARG00000004780
- ZFIN ID:
- ZDB-GENE-030131-6705
- Human Orthologue:
- CCDC142
- Human Description:
- coiled-coil domain containing 142 [Source:HGNC Symbol;Acc:25889]
- Mouse Orthologue:
- Ccdc142
- Mouse Description:
- coiled-coil domain containing 142 Gene [Source:MGI Symbol;Acc:MGI:3045292]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35674 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31978 | Nonsense | Available for shipment | Available now |
sa45511 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35674
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006181 | Nonsense | 192 | 1024 | 4 | 12 |
ENSDART00000144380 | Nonsense | 192 | 1024 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18754423)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14548876 GRCz11 14 14854439 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTACAACACCTGATGGACCAAAGAGCCCAGCTGCTCTTCTTCCATGAATA[C/A]GCCCGACGCACACAAATGGCCACCTGCTTTGTTGCTCAATTAGGCTCGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31978
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006181 | Nonsense | 417 | 1024 | 4 | 12 |
ENSDART00000144380 | Nonsense | 417 | 1024 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18755096)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14549549 GRCz11 14 14855112 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTGGCGAATAACCCCAAGGAACTCAAAGGTCACACTAAACTTAACAGT[C/T]GACTTTTATCATCACCCACAATAAACTTACATACAGTACAACTTGAACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45511
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006181 | Nonsense | 670 | 1024 | 6 | 12 |
ENSDART00000144380 | Nonsense | 670 | 1024 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18757221)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14551674 GRCz11 14 14857237 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTTATTCTTCAGCTCTTCCTACCTCTCCATACAGTTCTTCAGTTACTG[C/T]AACACCCAGACATAGAGTCAGGTACTCAACTTTACACTTTTGCCATCTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: