wdr36

Ensembl ID:
ENSDARG00000004774
ZFIN ID:
ZDB-GENE-030131-464
Description:
WD repeat-containing protein 36 [Source:RefSeq peptide;Acc:NP_955860]
Human Orthologue:
WDR36
Human Description:
WD repeat domain 36 [Source:HGNC Symbol;Acc:30696]
Mouse Orthologue:
Wdr36
Mouse Description:
WD repeat domain 36 Gene [Source:MGI Symbol;Acc:MGI:1917819]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33722 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14176 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Essential Splice Site 97 896 3 23
Genomic Location (Zv9):
Chromosome 5 (position 57308999)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55229598
GRCz11 5 55899815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGCAGCATATGGAAAACTTATCTCCGCTTTTGCTAGAAGCAGAGAG[G/A]TAAAGTATACATAGACACGCAGTGCATTGCATAACACTGGAGTGAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014049 Nonsense 637 896 17 23
Genomic Location (Zv9):
Chromosome 5 (position 57288983)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55209582
GRCz11 5 55879799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGGGAACTTCCTGGCCTCGTCGCACGTTGACGGCCTCGGTGTTTACTTAT[G/A]GTAAGAGATTGCWAWGCAGATACGTTCTTTGTGAACTCTTGTTTTCAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link