
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wdr36
- Ensembl ID:
- ENSDARG00000004774
- ZFIN ID:
- ZDB-GENE-030131-464
- Description:
- WD repeat-containing protein 36 [Source:RefSeq peptide;Acc:NP_955860]
- Human Orthologue:
- WDR36
- Human Description:
- WD repeat domain 36 [Source:HGNC Symbol;Acc:30696]
- Mouse Orthologue:
- Wdr36
- Mouse Description:
- WD repeat domain 36 Gene [Source:MGI Symbol;Acc:MGI:1917819]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33722 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14176 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33722
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014049 | Essential Splice Site | 97 | 896 | 3 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 57308999)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 55229598 GRCz11 5 55899815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTATGCAGCATATGGAAAACTTATCTCCGCTTTTGCTAGAAGCAGAGAG[G/A]TAAAGTATACATAGACACGCAGTGCATTGCATAACACTGGAGTGAATTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14176
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014049 | Nonsense | 637 | 896 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 57288983)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 55209582 GRCz11 5 55879799 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YGGGAACTTCCTGGCCTCGTCGCACGTTGACGGCCTCGGTGTTTACTTAT[G/A]GTAAGAGATTGCWAWGCAGATACGTTCTTTGTGAACTCTTGTTTTCAATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Eosinophil counts: Sequence variants affecting eosinophil numbers associate with asthma and myocardial infarction. (View Study)
- Eosinophilic esophagitis (pediatric): Common variants at 5q22 associate with pediatric eosinophilic esophagitis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: