zgc:100868

Ensembl ID:
ENSDARG00000004748
ZFIN ID:
ZDB-GENE-040801-33
Description:
hypothetical protein LOC554458 [Source:RefSeq peptide;Acc:NP_001003526]
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5731 Essential Splice Site F2 line generated During 2018
sa33262 Nonsense Mutation detected in F1 DNA During 2018
sa13737 Nonsense Available for shipment Available now
sa33261 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa40129 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5731
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Essential Splice Site None 551 3 11
ENSDART00000135192 Essential Splice Site 81 498 3 10
ENSDART00000013553 Essential Splice Site None 551 None 11
ENSDART00000135192 Essential Splice Site 81 498 None 10
Genomic Location (Zv9):
Chromosome 3 (position 39481583)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39344943
GRCz11 3 39486801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCATTAACAACCAATGGATTCTGACTGCAGCCCATTGCTTTCCCAAG[T/G]ATAAAGWCAGGCAACAAGTCCTTTCAAAATACTGTATGTCATTTACCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Nonsense 152 551 6 11
ENSDART00000135192 Nonsense 255 498 6 10
Genomic Location (Zv9):
Chromosome 3 (position 39478522)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39341882
GRCz11 3 39483740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGAGTTTTGGTACAGGCTGTGCTCAACCAAACTTCCCTGGTGTGTA[T/A]ACCAGGGTGTCTAAATATCAGAGCTGGATCCAGCAGAGAATCACCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Nonsense 389 551 9 11
ENSDART00000135192 Nonsense 492 498 9 10
Genomic Location (Zv9):
Chromosome 3 (position 39474718)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39338078
GRCz11 3 39479936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAACTCATCCTCAAACAACAGTATTTGTACAACTGCTTTCGACTTA[C/T]AACAGGCAAGTTGTTTCTGSTTTTGTTTTGACTTTTTNGGTGAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Missense 392 551 10 11
ENSDART00000135192 Essential Splice Site 494 498 10 10
Genomic Location (Zv9):
Chromosome 3 (position 39470209)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39333569
GRCz11 3 39475427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGAAGGTAATAATCCTCTTCACTGTGTGTCTTTCACTCTCTTAGGGT[G/T]TTCAAGGTGGTCCACTGATGTGTTTGGTGGGTCAGTCATGGATCCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013553 Essential Splice Site None 551 None 11
ENSDART00000135192   None 498 10 10
Genomic Location (Zv9):
Chromosome 3 (position 39469449)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39332809
GRCz11 3 39474667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACACAAGTTTTTTTTTTTTTTTTAAACAGATTTAACAGTTTATCTTG[T/A]GTTTCACAAATTTTGGTAACACTTTATTTTGATGGTCCATTTGAGTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link